This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences AAGAAAGCCCAGTATACAGA and AGAACGTGATAAGCTTATGT, which resulted in a 171 bp deletion beginning at Chromosome 13 position 3,596,750 bp and ending after 3,596,920 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000618996 (exon 6) and 70 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 7 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count