CRISPR/Cas9 methodologies were used to delete 61 bp of mouse gene Car10 (including the last 32 bp of exon 2). The guide RNA (gRNA) sequences for the Car10 mutation were: TGAAGGCTGGTGGGCATACAAGG and CCAGGGAAGCTTTGTTCCAGGTA. The exon 2 sequence deletion involves chr11:93185125-93185185. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count