CRISPR/Cas9 methodologies were used to delete 40 bp from exon 2 of the mouse Car11 gene. Two sets of gRNAs were used to ensure the production of a Car11 mutation: exon1 - CCTGAGCGCCCCTCAAGCGCTGG and CACTGGGAGCGGCAGGTAAG, and exon 2 - GCTCTCTTCCCAGCTCACATCGG and CCGAGGACTGGTGGAGCTACAAG. A 40 bp deletion in exon 2 was produced - chr7:45700427-45700466. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count