This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTAGGTTCCATCGTCCTTG, TTTGAAGGTCCAAGTGGAAG, GCAGGGCCACCCAATCCGAT and GTGTGGCTGTTGTGACCCAA, which resulted in a 845 bp deletion beginning at Chromosome 1 position 87,184,358 bp and ending after 87,185,202 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000985401 and ENSMUSE00001040282 (exons 3 and 4) and 601 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 9 amino acids later. (J:188991)