Ccdc170^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences AGAGAAAATGAAATTGGACG and GATAGCCACTAACAAACTGG, which resulted in a 359 bp deletion beginning at Chromosome 10 position 4,513,980 bp and ending after 4,514,338 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001373388 (exon 3) and 102 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 59 and early truncation 6 amino acids later. (J:188991)