This allele from project TCPR0586 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CCAGCCAGGCGGACCTCCCG and GATACGGGCCACATCTTCCA targeting the 5' side and CCAGGAGCCTCCGGGTACTA and TCCCAGTAGCTAACAAAGGC targeting the 3' side of exon ENSMUSE00000599706 resulting in a 121-bp deletion of Chr7 from 16994632 to 16994752, and c.197delC (22-bp downstream of gRNA_U3). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count