This allele from project TCPR0861 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCGCCCTTGTTGTGCACAAA and CCTGTAATGCAGAGTATGTA targeting the 5' side and GTCTAACTGGAGAGTATCAT and GGCATGCAGCTCTAGGTTGT targeting the 3' side. This resulted in a 974-bp deletion from Chr9: 86619475 to 86620448 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count