This allele from project TCPR0893 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGCTTCCCTGAGGTCCCTTT, GCAGGACCCAAAGGTGCCCC, and ATGGTACTTACCCCAAGTCC. This resulted in a 2160-bp deletion on Chr2 from 180600526 to 180602685 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count