This allele from project TCPR0441 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TTGTGTAAGGTTGTCACTGA and ATCATGCAGATTTTTCACTC targeting the 5' side and CCTGTAGTATTTCCACTGAT and TATAGCCTATCTAGTGGTGT targeting the 3' side of exon ENSMUSE00001035727 (exon 4). This resulted in a 9-bp deletion of Chr1 from 107080984 to 107080992, and a 388-bp deletion of Chr1 from 107080541 to 107080928 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count