This allele from project TCPR0446 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CTGAGCAGCTACTAGAGGCT and TGAGCCTGGCTGTGGCACAT targeting the 5' side and TCTTGCTCACCCTCGCTGTT and GCCTAGAGCTCATAAGCGAA targeting the 3' side of exons ENSMUSE00001302781 (exon 2) and ENSMUSE00001204778 (exon 3). This resulted in a 854 bp deletion of Chr4 from 21683245 to 21684098. (GRCm38). (J:237616)