This allele from project TCPR0860 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GTAATACCAGTTCTTAACAA and TCTCTTTAGACTACCAACGG targeting the 5' side and AGACGGCAAAAGTGCTGGAT and TTCACCGTTTGCAATTTTGA targeting the 3' side leading to a 835-bp deletion from ChrX:153382333 to 153383167_insAAGTAGTGATAATAG (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count