This allele from project TCPR0991 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CATCCGTTTGTAGTGTTGTC targeting the 5' side and GTGATTCTATACTTATAACC targeting the 3' side of a critical exon. This resulted in a 1256-bp del Chr19: 44061802 to 44063066 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count