This allele from project TCPR1060 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GTATCCCTAGGCGTGAACAA and CCGTTTAAGCTCTTAGACTT targeting the 5' side and TCTCACCACATAAGAGTATT targeting the 3' side.This resulted in a 920-bp deletion from Chr1: 134463234 to 134464153_insGG. (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count