This allele from project TCPR0865 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCGATCTTCAGAGTGCTCTC and CGAGGAGCAGTCCTCCGAGG targeting the 5' side and CATATTAAATAGGGTAAGGG targeting the 3' side of a critical region. This resulted in a 455-bp deletion ChrX:136708844 to 136709298 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count