This allele from project TCPR0846 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GTTCGATGCTAGCCCACAGC and AGCTCCTGCGATTTCACCTG targeting the 5' side and TGGAGTTCCTCGGAGTGATC and GCAATGATCGTGACCTGTCC targeting the 3' side leading to a 263-bp deletion from Chr19: 7578954 to 7579216 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count