This allele, from project TCPR0416, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences GTGGTCGAATCCACAGCCAA, GTTGCACACCCTGATGAATA, GCATGCATGGTCGTGCCTGT and TTGAGCACGAGCACACCCAC. This resulted in a 858-bp deletion in Chr13 from 73940000 to 73940857 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count