This allele from project TCPR1025 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having with spacer sequences of GCCTGAGGACCCCATAACAT and ACATTCCATGTGGTACCTAT targeting the 5' side and CCTGCCATATGACCATGCTA and AGCGTAGGTGAGTCTATTGA targeting the 3' side of a critical region. This resulted in a 826-bp deletion from Chr7:141246719 to 141247544 (GRCm38). (J:237616)