This allele from project TCPR0755 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs having spacer sequences of GAGAGCGGCCGGGCAGCCCC and CGGGTGCATTGTCCTCGGAG targeting the 5' side and AGGAGCACCATAGCTGCTTC and CATTTTCCAAGTGGCCCCGC targeting the 3' side of a critical region. This resulted in a 1,842-bp deletion of Chr6 from 120492099 to 120493940_insTGAGCTGGGGGAGCGC (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count