This allele from project TCPR0790 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs with spacer sequences of GAGAGCTGTGCTTAAACTCG and ACGTGCCAAAACTGCCCTGT targeting the 5' side and CACTGGGCAATCATGACTAC and TGTCAGAGTTATGACAGTGG targeting the 3' side of exons ENSMUSE00000098735, ENSMUSE00000724134, and ENSMUSE00001304146 resulting in a 1750-bp deletion of Chr10 from 57800808 to 57802557 and a 1-bp deletion of Chr10: 57802633 (GRCm38). (J:237616)