This allele from project TCPR0785 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCCAAGCCTAAGAACACACT and GGGAACAAGGATAGACTTGC targeting the 5' side and GGCTTTCGCTTAGCGCTCCT and AGTCTGCGTCACTAAGTCAC targeting the 3' side of exon ENSMUSE00001152754. This resulted in a 1572-bp deletion Chr11: 33492917 to 33494488 gRNA_U5 to _D3 (GRCm38). (J:237616)