This allele from project TCPR0864 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GCAGTTGGATTAAGTAGCAC and TCTTTGGTCTAGCGAGATTG targeting the 5' side and TCCTAGAGCTATGGACATGG and GTGCATACCTCTAGCAGCCC targeting the 3' side of a critical region. This resulted in a 12-bp deletion Chr6:28519921 to 28519932; 325-bp deletion Chr6:28520030 to 28520354; 11- bp deletion Chr6:28520400 to 28520410 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count