This allele from project TCPR1038 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCTGATAGAGCTCATGTAGC targeting the 5' side and AGTTTACACGACAACAGACC targeting the 3' side of a critical exon. This resulted in a 812-bp del Chr18:34795059 to 34795870_insG (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count