This allele from project TCPR0867 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACGGAGTGCGTCTCCCTGAA and ATTATAGAAACATGGTCCCC targeting the 5' side and CCTAAGGGGACCTAATGCAA and TTTCCCGCCTGATGACCTAT targeting the 3' side of a critical region. This resulted in a 1,227-bp deletion from Chr2:59771703 to 59772929 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count