This allele, from project TCPR0419, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences ACGGCCGCGCGTCCCCTGCC, AAGACAGGGACGGTCAGCGG, GTCCGGCGTCCCGGGGCGAC and ACCCCGCCACCGCGAGCCCT. This resulted in a 837-bp deletion in Chr16 from 96081676 to 96082512 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count