This allele from project TCPR0993 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTTGCTCCAGGAGTCCGGGT and CCTGATTGTTGCCTTGGACC targeting the 5' side and AGGTACTACGGATCCTTCTG and CCAACTGCATGTTCGTGAAG targeting the 3' side leading to a 549-bp deleltion from Chr11:70601540 to 70602088 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count