This allele from project TCPR0903 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CAGGGTATATGAGCATTAAT and GTCGTGACACCCAGCTTAGA targeting the 5' side and CGTGGCCACGCGCTGTAATC and GTGGGCCACTCGTTCATCCC targeting the 3' side of exon ENSMUSE00001230926. This resulted in a 1794-bp deletion of Chr17 from 70655896 to 70657689 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count