This allele from project TCPR1050 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCTGGTCACAGCAGTGTCGC and ATGTCTGAGTTCGGTTCTTG targeting the 5' side and AAGCAGGTGAGGACCCGTAA and GGTGGCAGGAATAGCAAATC targeting the 3' side of a critical exon. This resulted in a 272-bp deletion of Chr11 from 66155405 to 66155676 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count