This allele, from project TCPR0433, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences GTTCGATCCTCGCTGGCCAG, CGCTACCAGGTGTTCTTCTT, GCGGTCCAGGGCCTGATTGT and TCTACAAACACCGTGACTAC. This resulted in a 789-bp deletion in Chr13 from 26769233 to 26770021 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count