This allele from project TCPR0693 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TAGCACCCAGGCTCTAGCAG and CCTTAACAAGCCTAGGCCTC targeting the 5' side and ACATACCTGCCTCCCGGTAC and TGCCACCTCACACTGCGTGG targeting the 3' side of exon ENSMUSE00000488731 resulting in a 266-bp deletion of Chr7 from 25638173 to 25638438, insAGAGCCT (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count