This allele from project TCPR0671 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GAGCTATATACGCCTGACCT and GTGCTTAGTCGGGGTTGATT targeting the 5' side and GACCACCCAAGGGTCCCGTC and TCACCTCCAAGGGTCAAGCG targeting the 3' side of exon ENSMUSE00000516175. This resulted in a 283-bp deletion of Chr7 from 30623398 to 30623660 and an indel at Chr7:30623292_insC (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count