This allele from project TCPR0781 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGTCACTACTGAGAAACTAC and CCTAAGAAAGGATTTCCCTC targeting the 5' side and ATTCTGGTAAGTGTATAACG and GACTCAGTCACACCAGGTGG targeting the 3' side of exon ENSMUSE00000449145. This resulted in a 314-bp deletion of Chr17 from 27793890 to 27794203 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count