This allele from project TCPR0513 was generated at The Centre for Phenogenomics by injecting Cas9 endonuclease and a guide RNA with the spacer sequence GAAAGAGGAGCATTAGTCAT [and a single-strand oligonucleotide encoding the changes c.105_112delAGTCATT to inactivate the PAM sequence and prevent re-cutting of the repaired allele in ENSMUSE00001289515]. Subsequent NHEJ-mediated repair introduced an indel comprised of a 7-bp deletion of Chr18 from 50130173 to 50130179 (GRCm38) (p.V36*). (J:237616)