This allele from project TCPR0837 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with 4 single guide RNAs with spacer sequences of CACTTTAATCTAAGGCAAGA and GATTGCTGTAGGGCCATTGC targeting the 5' side and GTGATACCTACAGCATTCGG and GGTAGGACTTGTCTAAACAC targeting the 3' side of exon ENSMUSE00000591449 resulting in a 311-bp deletion of Chr7:82575904 to 82576214 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count