This allele from project TCPR0948 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CATCACCATACTCTGCCTTC and TATAGGTTGATTTATCTGAC targeting the 5' side and TCATTTGTGCTAGGAAGAGC and TAACTGCATGCTTGTAAGTT targeting the 3' side of a critical region. This resulted in a 308-bp deletion ChrX:102636569 to 102636876 (GRCm38). (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count