This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, the guide sequence targeting TACGGTACCTGGGCTCTGCAGGG, and a donor oligo. The engineered point mutation results in a change of amino acid 23 of the protein sequence from glutamic acid to lysine. (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count