This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences ATGGAATCAGATGTGGTCTAGGG and CCAGGCAGTACTACAGGTACTGT, which resulted in a 391 bp deletion beginning at Chromosome 12 position 81,510,784 bp and ending after 81,511,174 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001300363 (exon 2) and 254 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 22 and early truncation 18 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count