Ier3ip1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTATACTTAATATCTTCACAGGG, TCAGTCTTCAGGGCTGTCAGCGG, CCATCTTTACTGAACTGAACACC and CCTTGCGTAACTTTTAAGTTACT, which resulted in a 2581 bp deletion beginning at Chromosome 18 position 76,939,313 bp and ending after 76,941,893 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001271873 and ENSMUSE00001293257 (exons 2 and 3) and 1386 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 11 amino acids later. (J:188991)