Gcsh^em1(IMPC)H

This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CCCAAGTTCAAGACCTAGCTGGG, AGGCTAGAGCCGTACCTCAGTGG, AACACACTTTCCCCACTCGGAGG, ACTTTCCCCACTCGGAGGTCTGG, which resulted in an Exon Deletion. The allele carries a 643 base pair deletion that encompasses the entire exon 3, creating a frame-shift after exon 2 (amino acid 73) and is predicted to be a null allele. (J:237616, J:302097)