CRISPR/Cas9 genome editing technology was used to generate a 191bp deletion that included exon 8 of the gene. This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences CCATGTATGTAGGCAAACTTGGC, TGTTAATGTCTTCTGCTATCAGG, CAACAGGGCAGGTAAGACGAAGG, TAAGAGTATTTCAGTGGACTAGG. (J:237616, J:332580)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count