Eml4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences TTGTAAAACTCTGCTCCTTA and TCATCATGCACAGTTGTTCA, which resulted in a 216 bp deletion beginning at Chromosome 17 position 83,421,557 bp and ending after 83,421,772 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000484417 (exon 3) and 86 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 69 and early truncation 43 amino acids later. (J:188991)