Krt25^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAGAGGCCAGCCTTAGCCG, GTGAGCGAAAAGAATCCATG, GCATGCTACATGATTACTAG and TTAAGGGCATTTAAGGGCAT, which resulted in a 357 bp deletion beginning at Chromosome 11 position 99,321,844 bp and ending after 99,322,200 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000972994 (exon 2) and 274 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 10 bp deletion (ATCCCTTAAA) 160 bp after the 357 bp deletion, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 139 and early truncation 13 amino acids later. (J:188991)