Naa16^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTATGTTTCGAGTGAATCTT, TATCTGAAGCACTTCTGAGA, ATTAATTTCAGCATTAAGTG and GTCTCTATCTCTTACAATAG, which resulted in a 492 bp deletion beginning at Chromosome 14 position 79,386,780 bp and ending after 79,387,271 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001292003 (exon 2) and 407 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 18 and early truncation 4 amino acids later. (J:188991)