This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCATTATAACGGGAATTCAT, AGTTACGTAAACATTTGTAG, CAGAATGCGAAGTAAACCTT and GCTTGTATGTAGGTCTCCTC, which resulted in a 579 bp deletion beginning at Chromosome 10 position 63,169,099 bp and ending after 63,169,677 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000420052 (exon 3) and 403 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 9 bp insertion (TGCCTTGGT) at the deletion site and a single bp insertion (A) 38 bp after the exon deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 299 and early truncation 4 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count