Arhgap21^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGAGTGCTCTCAGAACCCAT, TTAGCCCACTGATTGTTGAG, TGTGGAGCTCAGACAGCAAC and GAGCAGTTTGATGTTTTAAA, which resulted in a 432 bp deletion beginning at Chromosome 2 position 20,889,665 bp and ending after 20,890,096 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001249954 (exon 5) and 353 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 126 and early truncation 8 amino acids later. (J:188991)