This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CCAGTGTGTTCATGGCGGAGCCA, TCCACAAAACCCAGTAAAGTTGG, CCAGCCCCCAAATGTCTTTTTAG, TTAGTCTCCAACATCCCTTGTGG, which resulted in a 1262 nt deletion in exons ENSMUSE00000487442 and ENSMUSE00000486780. (J:237616, J:337481)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count