Hnrnph2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences CACCATGATGCTGAGCACAG and TTGAGTTTTCCTGAAGAACT which resulted in a 1451 bp deletion beginning at Chromosome X position 134,604,908 bp and ending after 134,606,358 bp (GRCm38/mm10). This mutation deletes most of the coding sequence of ENSMUSE00000653740 (exon 4) leaving 53 bp of 5 UTR with the deletion beginning just before the ATG and ending in the 3-prime UTR 100 bp after the TAA stop. This is predicted to result in a null allele. (J:188991)