Ralgapa1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences AATTAAGTTCTTCAAAAGGC, TATGCTAAGGAGTAGTGAGA and TTTAGACAAATGCTAAATCA, which resulted in a 313 bp deletion beginning at Chromosome 12 position 55,794,879 bp and ending after 55,795,191 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000370584(exon 3) and 263 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 4 bp deletion (TGAG) 15 bp before the 313 bp deletion that will not alter the results of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 72 and early truncation 17 amino acids later. (J:188991)