This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences GATGTATGAGGGTAAGATGCAGG, TACTTCAAAGCTGATGTATGAGG, CCCTGCCTAGACCCTTTAAAAGG, CAGCTGAAATCTGGGACCTAGGG, which resulted in a 400-bp exon deletion, including a critical exon to generate a knock-out. (J:237616)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count