Prrc2c^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGCTGAACAGTGCACAGCGG, ACTCTATTCTTGGAGTTAGT, ATAGAGCTCTACTTTAACAT and AGATGGCTTAATATTTTGAG, which resulted in a 757 bp deletion beginning at Chromosome 1 position 162,722,830 bp and ending after 162,723,586 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001264518 (exon 3) and 579 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 37 and early truncation 19 amino acids later. (J:188991)