This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTGCTCAGTGAGGAATGCTA, GCCAAGCTGGACTTATGTAG, GTATCAGGCAGCCTGCGTGG and ACACGGGACGTTTCTCAAAG, which resulted in a 655 bp deletion beginning at Chromosome 11 position 59,727,305 bp and ending after 59,727,959 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001091723 (exon 4) and 503 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 89 and early truncation 33 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count